"Heyuan Liji" is a joint venture between Heyuan Biotechnology (stock code: 688238) and Liji Biotechnology, specializing in the "Liji Biotechnology" and "Life-ilab" reagent brands
click to copy
The EZ Trans Lentiviral Infection Kit from Heyuan Liji includes essential components such as lentiviral packaging plasmids, control plasmids, transfection reagents (EZ Trans Regent), lentiviral concentrates, lentiviral infection enhancers, etc. It can efficiently complete the entire process of virus packaging to infected cells in one stop. The Lentiviral Infection Kit provides sufficient and high-quality control plasmids and packaging plasmids, eliminating the need for experimental personnel to extract plasmids and quickly packaging virus-infected cells.
The expression system of HeYuan LiJi lentivirus vector consists of pLenti lentivirus vector and Lentiviral Mix plasmid. The pLenti slow vector contains HIV basic elements 5 'LTR and 3' LTR, as well as other auxiliary elements such as WPRE. The expression frame is U6 shRNA (NC) - CMV-EGFP-2A-Puro, which contains green fluorescence and puro eukaryotic resistance. Customers can modify the plenti vector according to different experimental purposes for promoter, gene function research, stable strain screening, etc. Lentiviral Mix can express various essential components required for virus packaging and is compatible with second-generation and third-generation slow virus packaging systems.
Item number | Specifications | Components | ||||
A: Control plasmid | B: Packaging plasmid | C: Transfection reagent | D: Infection enhancer | E: Lentivirus concentrate | ||
AC04L605 | 5T | 16μL | 110μL | 450μL | 60μL | 12.5mL |
AC04L610 | 10T | 32μL | 220μL | 900μL | 120μL | 25mL |
AC04L620 | 20T | 64μL | 440μL | 1800μL | 240μL | 50mL |
Blue ice transportation. A. Component B is stored at -20 ℃, while components C, D, and E are stored at 4 ℃, with a shelf life of 12 months.
Clone serial number: | GL427NC2 | Sequence name: | ShRNA(NC) | |
Species: | NC | Upstream and downstream cloning enzyme cleavage sites | AgeI | EcoRI |
Prokaryotic resistance: | Amp | |||
Built name: | pSLenti-U6-shRNA(NC2)-CMV-EGFP-F2A-Puro-WPRE | |||
Primers for forward sequencing: | 7#hU6-F2 TACGATACAAGGCTGTTAGAGAG | |||
Reverse sequencing primers: | 8#pY-SEQR CTATTAATAACTAATGCATGGC | |||
Other instructions |
| |||
This product is only for scientific experimental research and should not be used in clinical diagnosis, treatment, or other fields.
Q:If the plasmid is accidentally placed at 4 ℃, can it still be used?
A:The plasmid of Li Ji Biology is very stable, and there is basically no problem at 4 ℃ for two weeks; For long-term storage, it is recommended to store at -20 ℃ or -80 ℃.
Q:What is the concentration of plasmids? Do we still need to remove endotoxins?
A:Li Ji Biology provides a plasmid concentration of 1ug/uL, so customers do not need to remove endotoxins anymore.
Q:If you think the provided plasmid concentration is not enough, can you transform it yourself? What resistance is used?
A:It can be self transformed, Amp resistant.
Fill in the product batch number for querying
Fill in the product batch number for querying
Hot-sale Product
Hot Articles